View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12608_low_11 (Length: 244)

Name: NF12608_low_11
Description: NF12608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12608_low_11
NF12608_low_11
[»] chr2 (1 HSPs)
chr2 (23-165)||(36138510-36138648)


Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 23 - 165
Target Start/End: Complemental strand, 36138648 - 36138510
Alignment:
Q  23 catttgttttgtttttgataaaattattttttctatgatattcttgattgtttaatatctcattgcacgtaannnnnnnnnnnnctctggtgtgaattgg 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||            ||||||||||||||||    
T  36138648 catttgttttgtttttgataaaattattttttctatgatattcttgattgtttaatatctcattgcacgtaa----ttttttttctctggtgtgaattgg 36138553  T
Q  123 atatttggtgtgaaattgtgaagattaatctcctagcttaggt 165  Q
    |||||||| ||||||||||||||||||||||||||||||||||    
T  36138552 atatttggcgtgaaattgtgaagattaatctcctagcttaggt 36138510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University