View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12600_high_20 (Length: 257)

Name: NF12600_high_20
Description: NF12600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12600_high_20
NF12600_high_20
[»] chr3 (1 HSPs)
chr3 (12-257)||(23176526-23176772)


Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 12 - 257
Target Start/End: Original strand, 23176526 - 23176772
Alignment:
Q  12 agcataggcttggctgacactaaattgccccggttttgatttggcacacgaaaaatgttgcaacagcttcgtagatgattctaatttgcttctggcttcg 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23176526 agcataggcttggctgacactaaattgccccggttttgatttggcgcacgaaaaatgttgcaacagcttcgtagatgattctaatttgcttctggcttcg 23176625  T
Q  112 aagcacacaaaattcctgtagtgtttctaggagcaatggattaaggtgccgcctcatgttttgctcattgcttaatgtacttctgttgttctcccatgat 211  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  23176626 aagcacacaaaattcctgtagtgtttctaggagcaatggattaaggtgccacctcatgttttgctcattgcttaatgtacttctgttgttctcccatgat 23176725  T
Q  212 ataataa-cctcttgcaacggccatacgcccttgcttcagtgcttga 257  Q
    |||| || |||||||||||| ||||||||||||||||| ||||||||    
T  23176726 ataacaaccctcttgcaacgaccatacgcccttgcttccgtgcttga 23176772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University