View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12598_low_108 (Length: 214)

Name: NF12598_low_108
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12598_low_108
NF12598_low_108
[»] chr4 (2 HSPs)
chr4 (15-195)||(38933831-38934011)
chr4 (30-195)||(12156014-12156179)


Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 15 - 195
Target Start/End: Original strand, 38933831 - 38934011
Alignment:
Q  15 catagggtgaatattttgccgtatttttgtgaaaggttgtgaagggaacggtggagtgggaggtttatgttgtggaggtttcctattatgggaagagata 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38933831 catagggtgaatattttgccgtatttttgtgaaaggttgtgaagggaacggtggagtgggaggtttatgttgtggaggtttcctattatgggaagagata 38933930  T
Q  115 ttgatggacctggtggaaggtttttgaaatttcttctttggagtaaaagtttcaaggttacaatgaaactaagggaaagga 195  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38933931 ttgatggacctggtggaaggtttttgaactttcttctttggagtaaaagtttcaaggttacaatgaaactaagggaaagga 38934011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 30 - 195
Target Start/End: Original strand, 12156014 - 12156179
Alignment:
Q  30 ttgccgtatttttgtgaaaggttgtgaagggaacggtggagtgggaggtttatgttgtggaggtttcctattatgggaagagatattgatggacctggtg 129  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |||||||| |||||||| ||||||||||| |||||    
T  12156014 ttgccgtatttttgtgaaaggttgtgaagggaacggtggagtgggaggttgatgtagtggaggtgtcctattaagggaagagttattgatggacttggtg 12156113  T
Q  130 gaaggtttttgaaatttcttctttggagtaaaagtttcaaggttacaatgaaactaagggaaagga 195  Q
    |||||||||| || ||||||||||| ||||||||||||||||| | ||||||||||||||||||||    
T  12156114 gaaggtttttaaactttcttctttgtagtaaaagtttcaaggtaaaaatgaaactaagggaaagga 12156179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University