View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12595_low_36 (Length: 335)

Name: NF12595_low_36
Description: NF12595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12595_low_36
NF12595_low_36
[»] chr7 (1 HSPs)
chr7 (126-328)||(48250706-48250909)


Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 126 - 328
Target Start/End: Complemental strand, 48250909 - 48250706
Alignment:
Q  126 cgaggaggaagataaggcaaagcagagcagcgagtaacgttggtggttgtcaatagccgatgaggaactaacactgtgcctgcacttgctgcaaccgcca 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48250909 cgaggaggaagataaggcaaagcagagcagcgagtaacgttggtggttgtcaatagccgatgaggaactaacactgtgcctgcacttgctgcaaccgcca 48250810  T
Q  226 ttgtctctcacttttcttcactgttatcctt-ttttcctatgttaagaattaagattcaatgtttttgtttgtttgaggaaaatagagaaaccacccttt 324  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48250809 ttgtctctcacttttcttcactgttatcctttttttcctatgttaagaattaagattcaatgtttttgtttgtttgaggaaaatagagaaaccacccttt 48250710  T
Q  325 gctt 328  Q
    ||||    
T  48250709 gctt 48250706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University