View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12584_low_6 (Length: 245)

Name: NF12584_low_6
Description: NF12584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12584_low_6
NF12584_low_6
[»] chr7 (1 HSPs)
chr7 (6-227)||(11326855-11327078)


Alignment Details
Target: chr7 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 6 - 227
Target Start/End: Complemental strand, 11327078 - 11326855
Alignment:
Q  6 tcagagttacaaacaaagtttaattggtattgtaaactgaatcgtaat-gtnnnnnnnnnnnnaa-ttgtttgtaacactgaaaccatattatctaatta 103  Q
    |||||||||||||||||||||| ||||||||||||||||||| ||||| ||            || |||| |||||||||||||||||||||||||||||    
T  11327078 tcagagttacaaacaaagtttagttggtattgtaaactgaatggtaatagtatatatatatataaattgtatgtaacactgaaaccatattatctaatta 11326979  T
Q  104 acaaataaaaatacctgtgttcgttccccctnnnnnnnnnnnnnnnnngtacctgtcttccatccatgaaatgctgtagagatctcccaaacaaatatca 203  Q
    |||| ||||||||||||||||||||||||||                 ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11326978 acaattaaaaatacctgtgttcgttccccctaaaaaacaataaaaaaagtacctgtcttccatccatgaaatgctgtagagatctcccaaacaaatatca 11326879  T
Q  204 tactcaggtggtggaggaacatat 227  Q
    ||||||||||||||||||| ||||    
T  11326878 tactcaggtggtggaggaagatat 11326855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University