View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12579_low_58 (Length: 234)

Name: NF12579_low_58
Description: NF12579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12579_low_58
NF12579_low_58
[»] chr8 (1 HSPs)
chr8 (10-160)||(11438695-11438845)


Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 11438845 - 11438695
Alignment:
Q  10 aggagcagagaaatgttgtaacttcttcttcttgtttcagcatgttgttgatctcttgaggatgttgttcgatctggttcctggttttgggtcggtgggt 109  Q
    |||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |    
T  11438845 aggagcagagaagtgttgtaacttcttcttcttgtttcaacatgttgttgatctcttgaggatgttgttcgatctagttcctggttttgggtcggtggat 11438746  T
Q  110 cgtgtggatcccttggctgattgggttaaggattcgtagcatgtctgccga 160  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  11438745 cgtgtggatcccttggctggttgggttaaggattcgtagcatgtctgccga 11438695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University