View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12552_low_27 (Length: 218)

Name: NF12552_low_27
Description: NF12552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12552_low_27
NF12552_low_27
[»] chr4 (1 HSPs)
chr4 (8-208)||(935229-935429)


Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 8 - 208
Target Start/End: Original strand, 935229 - 935429
Alignment:
Q  8 gacgagccgccactcctaaaagccgaagaatctgccgatgaagcacccgacgaacacgaagcattcatcgccatattctccatccccacacccccacaat 107  Q
    |||||| ||||||| ||| ||||||||||||||| |||||||||| |||||||||||||||||||||||| |||||||| |||||||||| |||||||||    
T  935229 gacgaggcgccactactacaagccgaagaatctgtcgatgaagcatccgacgaacacgaagcattcatcgacatattcttcatccccacaaccccacaat 935328  T
Q  108 gaccccgccgcttcaaaaccgccggtgtgaccaccacacactgcggcgaagttttcttcttctccgtttcgggcgccggcaccggtttcttcacattctt 207  Q
    || ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  935329 gatcccgccgcttcaaaaccgccggtgtaaccaccacacactgcggcgaagttttcttcttctccgtttcgggcgccggcaccggtttcttcacattctt 935428  T
Q  208 c 208  Q
    |    
T  935429 c 935429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University