View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1255-Insertion-3 (Length: 98)

Name: NF1255-Insertion-3
Description: NF1255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1255-Insertion-3
NF1255-Insertion-3
[»] chr1 (2 HSPs)
chr1 (39-98)||(48688020-48688078)
chr1 (8-43)||(48687926-48687961)


Alignment Details
Target: chr1 (Bit Score: 48; Significance: 5e-19; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 5e-19
Query Start/End: Original strand, 39 - 98
Target Start/End: Original strand, 48688020 - 48688078
Alignment:
Q  39 ttgttaacatatttgttttgacatacattttcagtttcaactttcacctcttgtaccgag 98  Q
    |||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||    
T  48688020 ttgttaacatatttgttc-gacatacattttcagtttcaactttcacctcttgtaccgag 48688078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 43
Target Start/End: Original strand, 48687926 - 48687961
Alignment:
Q  8 atatacactatacagttaatttgttacctttttgtt 43  Q
    ||||||||||||||||||||||||||| ||||||||    
T  48687926 atatacactatacagttaatttgttacttttttgtt 48687961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University