View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1254_low_92 (Length: 251)

Name: NF1254_low_92
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1254_low_92
NF1254_low_92
[»] scaffold0110 (1 HSPs)
scaffold0110 (29-225)||(2222-2418)
[»] chr1 (1 HSPs)
chr1 (146-227)||(17488227-17488311)


Alignment Details
Target: scaffold0110 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: scaffold0110
Description:

Target: scaffold0110; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 29 - 225
Target Start/End: Complemental strand, 2418 - 2222
Alignment:
Q  29 agctttatcatcttttacttccttttttccaaagagtttagtgacataagtcacacacac--taaatgcatggagcggattgaacccacgttccactata 126  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||  ||||||||||||||||||||||||||||||||||||||    
T  2418 agctttatcatcttttacttccttttttccaaagagtttagtgacacaagtcacacacacactaaatgcatggagcggattgaacccacgttccactata 2319  T
Q  127 atcaactaatcatgcagttgttcaagatgtatgtaaccggttagtataacacactctttattggatgttgatttatttggaagtctaaaaatgatgaaa 225  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||    
T  2318 atcaactaaccatgcagttgttcaagatgtatgtaaccggttagtataacaca--ctttattggatgttgatttatttggaagtctaaaaatgatgaaa 2222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 146 - 227
Target Start/End: Original strand, 17488227 - 17488311
Alignment:
Q  146 gttcaagatgtatgtaaccggttagtataacacactcttt---attggatgttgatttatttggaagtctaaaaatgatgaaact 227  Q
    |||||| ||| ||| ||| | |||||||||||||||||||   ||||||||||||||||||| |||||||| |||||| ||||||    
T  17488227 gttcaaaatgcatgcaactgattagtataacacactcttttttattggatgttgatttatttagaagtctagaaatgacgaaact 17488311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University