View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12538_low_36 (Length: 209)

Name: NF12538_low_36
Description: NF12538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12538_low_36
NF12538_low_36
[»] chr7 (2 HSPs)
chr7 (76-194)||(34356513-34356631)
chr7 (96-193)||(35047128-35047225)
[»] scaffold0543 (1 HSPs)
scaffold0543 (127-189)||(3919-3981)
[»] scaffold0492 (1 HSPs)
scaffold0492 (127-189)||(5465-5527)


Alignment Details
Target: chr7 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 76 - 194
Target Start/End: Complemental strand, 34356631 - 34356513
Alignment:
Q  76 attaccgtgataaaatttacataaaatttggttttgatgtgattcttgttgttcaattttaggggaagacaaaataagtgctctacctgattcacttctt 175  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||    
T  34356631 attaccgtgataaaatttacataaaattcggttttgatgtgattcttgttgttcaatttcaggggaagataaaataagtgctctacctgattcacttctt 34356532  T
Q  176 tattatattctttcctttg 194  Q
    |||||||||||||||||||    
T  34356531 tattatattctttcctttg 34356513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 96 - 193
Target Start/End: Original strand, 35047128 - 35047225
Alignment:
Q  96 ataaaatttggttttgatgtgattcttgttgttcaattttaggggaagacaaaataagtgctctacctgattcacttctttattatattctttccttt 193  Q
    ||||||||||||||||||||||||||  ||||||||||  ||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  35047128 ataaaatttggttttgatgtgattctccttgttcaattccaggagaagacaaaataagtgcgctacctgattcacttctttattatattctttccttt 35047225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0543 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0543
Description:

Target: scaffold0543; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 189
Target Start/End: Complemental strand, 3981 - 3919
Alignment:
Q  127 ttcaattttaggggaagacaaaataagtgctctacctgattcacttctttattatattctttc 189  Q
    |||||||  ||| ||||||| ||| ||||||||||| ||||||||||||||| | ||||||||    
T  3981 ttcaattccaggagaagacagaatcagtgctctaccggattcacttctttatcacattctttc 3919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0492 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0492
Description:

Target: scaffold0492; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 189
Target Start/End: Complemental strand, 5527 - 5465
Alignment:
Q  127 ttcaattttaggggaagacaaaataagtgctctacctgattcacttctttattatattctttc 189  Q
    |||||||  ||| ||||||| ||| ||||||||||| ||||||||||||||| | ||||||||    
T  5527 ttcaattccaggagaagacagaatcagtgctctaccggattcacttctttatcacattctttc 5465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University