View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1252_low_22 (Length: 310)

Name: NF1252_low_22
Description: NF1252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1252_low_22
NF1252_low_22
[»] chr8 (2 HSPs)
chr8 (105-310)||(8155730-8155944)
chr8 (84-117)||(8155973-8156006)


Alignment Details
Target: chr8 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 105 - 310
Target Start/End: Complemental strand, 8155944 - 8155730
Alignment:
Q  105 tcttttatacccttgtttattttaaaaacaacttaatattaatttctttttgagcactcttcattagtc-ttgatgattcggtcatttctttcatttaca 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||    
T  8155944 tcttttatacccttgtttattttaaaaacaacttaatattaatttctttttgagcactcttcattagtctttgatgattcggtcatttctttgatttaca 8155845  T
Q  204 a---------aacgaataattatttatatcatcatcgcgattcataagtctgagtataattttctacaaaattcgacacatttgaatcacttgatgatta 294  Q
    |         ||||| |||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  8155844 aaacgagtagaacgagtaattatttataccatcatcgcgattcataagtc-gagtataattttctacaaaattcgacacatttgaatcacttgatgatta 8155746  T
Q  295 tagtttcaaattagcc 310  Q
    ||||||||||||||||    
T  8155745 tagtttcaaattagcc 8155730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 84 - 117
Target Start/End: Complemental strand, 8156006 - 8155973
Alignment:
Q  84 ataactatgcacttgccaaactcttttataccct 117  Q
    ||||||||| ||||||||||||||||||||||||    
T  8156006 ataactatgtacttgccaaactcttttataccct 8155973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University