View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12528_low_24 (Length: 242)

Name: NF12528_low_24
Description: NF12528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12528_low_24
NF12528_low_24
[»] chr5 (1 HSPs)
chr5 (82-224)||(30266458-30266596)


Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 82 - 224
Target Start/End: Complemental strand, 30266596 - 30266458
Alignment:
Q  82 tgtattattaatacaaaaaagaggtaactgttttgagagaaaaggtatagaaactgtgtgcatgtgaaggtggatgaacgtgaacgtggttactcactca 181  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||    
T  30266596 tgtattattaatacaaaaaagaggtaactgttttgagagaaaaggtatagaaactgtgtgcatgtgaaggtggatgaacgtgaacgtgg----tcactca 30266501  T
Q  182 ctcactatgcaactttttcacgcggtttagtaaaatttgaaca 224  Q
    ||||| |||||||||||||||||||||||||||||||||||||    
T  30266500 ctcaccatgcaactttttcacgcggtttagtaaaatttgaaca 30266458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University