View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12527_low_15 (Length: 242)

Name: NF12527_low_15
Description: NF12527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12527_low_15
NF12527_low_15
[»] chr3 (2 HSPs)
chr3 (1-96)||(39521478-39521572)
chr3 (131-186)||(39521607-39521662)


Alignment Details
Target: chr3 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 39521478 - 39521572
Alignment:
Q  1 tcattgttctttttcttctctctttcatttatcaacgcacgttcttaatgaagaaatcgacgtttatgcgtaatgccgagaaatttcactttcaac 96  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39521478 tcattgttctttt-cttctctctttcatttatcaacgcacgttcttaatgaagaaatcgacgtttatgcgtaatgccgagaaatttcactttcaac 39521572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 131 - 186
Target Start/End: Original strand, 39521607 - 39521662
Alignment:
Q  131 taatccgaacgagagtcatgtgtgaattgtgatcaagtgaaactgaaacctcacga 186  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  39521607 taatccgaacgagagtcatgtgtgaattgtgatcaagtgaaactgaaaccacacga 39521662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University