View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1251_low_36 (Length: 258)

Name: NF1251_low_36
Description: NF1251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1251_low_36
NF1251_low_36
[»] chr6 (1 HSPs)
chr6 (12-156)||(24915867-24916011)


Alignment Details
Target: chr6 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 12 - 156
Target Start/End: Original strand, 24915867 - 24916011
Alignment:
Q  12 aaagggtcactgagaacatgtcatttggtcaattctagtagccgcatcagtattttttaccaagtttacaggctgagttaaggtcacttacaaatagtgg 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  24915867 aaagggtcactgagaacatgtcatttggtcaattctagtagccgcatcagtattttttacctagtttacaggctgagttaaggtcacttacaaatagtgg 24915966  T
Q  112 agtaactaatgtcagaatcaatgtaactagaataatggtttgccc 156  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
T  24915967 agtaactaatgtcagaatcaatgtaactagaataatggtttgccc 24916011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University