View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12516_low_7 (Length: 286)

Name: NF12516_low_7
Description: NF12516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12516_low_7
NF12516_low_7
[»] chr1 (2 HSPs)
chr1 (136-273)||(3098443-3098579)
chr1 (136-248)||(3092381-3092490)


Alignment Details
Target: chr1 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 136 - 273
Target Start/End: Complemental strand, 3098579 - 3098443
Alignment:
Q  136 tctagacggtgactgctttgtatttgcagctgctaaatgattgttggaaagcatttagaggtgaaattagtacacaatcaaatcttatctttacaaggaa 235  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3098579 tctagacggtgactgctttgtatt-gcagctgctaaatgattgttggaaagcatttagaggtgaaattagtacacaatcaaatcttatctttacaaggaa 3098481  T
Q  236 gccatcctctttactcatgctatggacaaaatttgatg 273  Q
    || |||||||||||||||||||||||||||||||||||    
T  3098480 gcgatcctctttactcatgctatggacaaaatttgatg 3098443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 136 - 248
Target Start/End: Complemental strand, 3092490 - 3092381
Alignment:
Q  136 tctagacggtgactgctttgtatttgcagctgctaaatgattgttggaaagcatttagaggtgaaattagtacacaatcaaatcttatctttacaaggaa 235  Q
    |||||| ||||| |||||||| ||||||||||||||||||||||||||||||||| ||| |||||   ||||||||||||||||||||||||||||||||    
T  3092490 tctagatggtgattgctttgtttttgcagctgctaaatgattgttggaaagcattcagaagtgaa---agtacacaatcaaatcttatctttacaaggaa 3092394  T
Q  236 gccatcctcttta 248  Q
    || ||||||||||    
T  3092393 gcgatcctcttta 3092381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University