View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12515_high_29 (Length: 249)

Name: NF12515_high_29
Description: NF12515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12515_high_29
NF12515_high_29
[»] chr8 (2 HSPs)
chr8 (24-245)||(18095792-18096008)
chr8 (207-249)||(18081571-18081613)


Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 24 - 245
Target Start/End: Complemental strand, 18096008 - 18095792
Alignment:
Q  24 attggcatagtcattgttgttgcccacttgaaaaggaaagagattggcgttggcattgttaccaccacccacttgaacaggaaaaagattggcattttca 123  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  18096008 attggcattgtcattgttgttgcccacttgaaaaggaaagagattggcgttggcattgttaccaccacccacttgaaaaggaaaaagattggcattttca 18095909  T
Q  124 tcacccacatcaccctctagaaaagcaatgtcattgacattgatttcgttaccaccacccatttgaaaaggaaaaggaaattgattggcattgtcacctt 223  Q
    |||||||| | |      | |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  18095908 tcacccacttga-----aaaaaaagcaaagtcattgacattgatttcgttaccaccacccatttgaaaaggaaaaggaaattgattggcattgtcacctt 18095814  T
Q  224 gctgttgaagaggaagtggcca 245  Q
    ||||||||||||||||||||||    
T  18095813 gctgttgaagaggaagtggcca 18095792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 207 - 249
Target Start/End: Complemental strand, 18081613 - 18081571
Alignment:
Q  207 attggcattgtcaccttgctgttgaagaggaagtggccattcc 249  Q
    ||||||||||| |||||| ||||||||||||||||||||||||    
T  18081613 attggcattgttaccttgttgttgaagaggaagtggccattcc 18081571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University