View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1249_low_44 (Length: 332)

Name: NF1249_low_44
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1249_low_44
NF1249_low_44
[»] chr7 (1 HSPs)
chr7 (105-222)||(30319664-30319782)


Alignment Details
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 105 - 222
Target Start/End: Original strand, 30319664 - 30319782
Alignment:
Q  105 atcataggcaccattggaaatgacccatttgcttcctaatcatnnnnnnncaatctttttcaatttttaacactacccac-nnnnnnnntcagctagatc 203  Q
    |||| ||||||||||||||||||||||||||||||||||||||       ||||| ||||||||||||||||||||||||         |||||||||||    
T  30319664 atcacaggcaccattggaaatgacccatttgcttcctaatcataaaaaaacaatccttttcaatttttaacactacccacaaaaaaaaatcagctagatc 30319763  T
Q  204 catgaattaaattcaaaag 222  Q
    |||||||||||||||||||    
T  30319764 catgaattaaattcaaaag 30319782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University