View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1249_low_42 (Length: 340)

Name: NF1249_low_42
Description: NF1249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1249_low_42
NF1249_low_42
[»] chr2 (1 HSPs)
chr2 (226-332)||(10973998-10974104)


Alignment Details
Target: chr2 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 226 - 332
Target Start/End: Original strand, 10973998 - 10974104
Alignment:
Q  226 gtgccggacatatttttgattcccacttttcacagcctcatctccatttctttttggtgccatcacctcaaacctaagtttaagtttttataaattctag 325  Q
    |||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  10973998 gtgccggacatatttttggttcccactttccacagcctcatctccatttctttttggtgccatcacctcaaacctaagtttaagtttatataaattctag 10974097  T
Q  326 aattatc 332  Q
    |||||||    
T  10974098 aattatc 10974104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University