View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12499_low_17 (Length: 210)

Name: NF12499_low_17
Description: NF12499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12499_low_17
NF12499_low_17
[»] chr6 (1 HSPs)
chr6 (11-198)||(15702573-15702760)
[»] chr2 (1 HSPs)
chr2 (97-129)||(23378347-23378379)


Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 11 - 198
Target Start/End: Complemental strand, 15702760 - 15702573
Alignment:
Q  11 agatggacatcacctttccaccacactccgtcgacatctttcagtttcttaattgcatttgctttcctcctctggtcggccttgctatggaaaatttttg 110  Q
    |||||| |||||||||||||||||||||||  ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  15702760 agatggtcatcacctttccaccacactccgaagacatctttcagtttcttaattgcatttgttttcctcctctggtcggccttgctatggaaaatttttg 15702661  T
Q  111 tatttctatcaccatccttcaaccatactgccatacttctctgcctccacaaaacctcatctgttctcaacaggttgtctctctgctt 198  Q
    |||||||||| ||||||||||||||||||||| |||| ||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  15702660 tatttctatccccatccttcaaccatactgccctactcctctgcctccacaaaaccttatctgttctcaacaggttgtctctctgctt 15702573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 97 - 129
Target Start/End: Complemental strand, 23378379 - 23378347
Alignment:
Q  97 atggaaaatttttgtatttctatcaccatcctt 129  Q
    ||||||| |||||||||||||||||||||||||    
T  23378379 atggaaattttttgtatttctatcaccatcctt 23378347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University