View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12494_low_10 (Length: 254)

Name: NF12494_low_10
Description: NF12494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12494_low_10
NF12494_low_10
[»] chr7 (1 HSPs)
chr7 (1-237)||(42038163-42038399)


Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 42038163 - 42038399
Alignment:
Q  1 acaagattctacggttccaactcatggctggatgtgtctcccactcatagaagaagtatgcactgccaagattttaccgagaaacacttccaccatcaaa 100  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  42038163 acaagattctacggttccaactcacggctggatgtgtctcccactcatagaagaagtatgcactgccaagattttaccgagaaacacttccacgatcaaa 42038262  T
Q  101 attttgccctatcgatcaaactttgccctatccaacaagaactcaacataaatagatcatcccaacaaagattagatcattgtgagagttccaaatagtc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42038263 attttgccctatcgatcaaactttgccctatccaacaagaactcaacataaatagatcatcccaacaaagattagatcattgtgagagttccaaatagtc 42038362  T
Q  201 cgctagacaacatgtcatacaagcgtcatgtcaaaca 237  Q
    ||||||||||||||||||||||||| |||||||||||    
T  42038363 cgctagacaacatgtcatacaagcgccatgtcaaaca 42038399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University