View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1248Ase25 (Length: 155)

Name: NF1248Ase25
Description: NF1248-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1248Ase25
NF1248Ase25
[»] chr2 (1 HSPs)
chr2 (8-149)||(10071895-10072036)


Alignment Details
Target: chr2 (Bit Score: 131; Significance: 3e-68; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 131; E-Value: 3e-68
Query Start/End: Original strand, 8 - 149
Target Start/End: Complemental strand, 10072036 - 10071895
Alignment:
Q  8 ctttctactaactagtagatactgtgctacaaatgcgggtgcttgaattcaaatagatactgatttaatgattcaaatagatactactaaatcataaact 107  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10072036 ctttctactaactagtagatactgtgctacaaatgtgggtgcttgaattcaaatagatactgatttaatgattcaaatagatactactaaatcataaact 10071937  T
Q  108 aggtagactcatatcaatatcaacttatangggatactatta 149  Q
    |||||||||||||||||||||||||||||  |||||||||||    
T  10071936 aggtagactcatatcaatatcaacttataatggatactatta 10071895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University