View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1248Ase23 (Length: 108)

Name: NF1248Ase23
Description: NF1248-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1248Ase23
NF1248Ase23
[»] chr2 (1 HSPs)
chr2 (7-98)||(41675870-41675961)


Alignment Details
Target: chr2 (Bit Score: 92; Significance: 3e-45; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 92; E-Value: 3e-45
Query Start/End: Original strand, 7 - 98
Target Start/End: Original strand, 41675870 - 41675961
Alignment:
Q  7 agtcctgttgtctagagtctctctctatagttctgttttgctctctgtgaccgttaactgtttactgcatatgtcatacagtacaacttacc 98  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41675870 agtcctgttgtctagagtctctctctatagttctgttttgctctctgtgaccgttaactgtttactgcatatgtcatacagtacaacttacc 41675961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University