View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12487_low_9 (Length: 329)

Name: NF12487_low_9
Description: NF12487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12487_low_9
NF12487_low_9
[»] chr8 (2 HSPs)
chr8 (12-171)||(28759234-28759393)
chr8 (195-314)||(28759094-28759213)
[»] chr5 (3 HSPs)
chr5 (26-164)||(13756613-13756748)
chr5 (99-150)||(27969538-27969589)
chr5 (209-267)||(13756522-13756580)
[»] chr3 (1 HSPs)
chr3 (106-150)||(46047065-46047109)


Alignment Details
Target: chr8 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 12 - 171
Target Start/End: Complemental strand, 28759393 - 28759234
Alignment:
Q  12 agagaggagaaaaaggaagagagaacaattgatagagagtatgatgttgtgtttgtgccatctgatggtggtgattggtgttttctgtctggttctgaat 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  28759393 agagaggagaaaaaggaagagagaacaattgatagagagtatgatgttgtgtttgttccatctgatggtggtgattggtgttttctgtctggttctgaat 28759294  T
Q  112 ctgatgattctgattggtctattgggtggttggagcctcttggttctgattttgaaagca 171  Q
    ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  28759293 ctgatgactctgattggtctattgggtggctggagcctcttggttctgattttgaaagca 28759234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 195 - 314
Target Start/End: Complemental strand, 28759213 - 28759094
Alignment:
Q  195 gattctggtggtgatagttttgctgttttggttccttgttattcacctggctgcaaggaaattgaaggttcaagcaatgtgcttttgaatgccatcaaga 294  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| ||||    
T  28759213 gattctggtggtgatagttttgctgttttggttccttgttattcacctggctgcaaggagattgaaggctcaagcaatgtgcttttgaatgccattaaga 28759114  T
Q  295 acctccctagtgagttttct 314  Q
    ||||||||| ||| ||||||    
T  28759113 acctccctaatgaattttct 28759094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 57; Significance: 9e-24; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 26 - 164
Target Start/End: Complemental strand, 13756748 - 13756613
Alignment:
Q  26 ggaagagagaacaattgatagagagtatgatgttgtgtttgtgccatctgatggtggtgattggtgttttctgtctggttctgaatctgatgattctgat 125  Q
    ||||||||| | | |||||||||||||||||||||| || ||  ||||||||||||||| | | |||||    || || |||||||||||||| || |||    
T  13756748 ggaagagaggagagttgatagagagtatgatgttgttttagtatcatctgatggtggtggtggttgttta---tcaggctctgaatctgatgactcagat 13756652  T
Q  126 tggtctattgggtggttggagcctcttggttctgatttt 164  Q
    ||||||||||||||||| ||||||| |||||||||||||    
T  13756651 tggtctattgggtggttagagcctcatggttctgatttt 13756613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 99 - 150
Target Start/End: Original strand, 27969538 - 27969589
Alignment:
Q  99 tctggttctgaatctgatgattctgattggtctattgggtggttggagcctc 150  Q
    |||||||||||||||||||||||||||||||| ||||| |||||||| ||||    
T  27969538 tctggttctgaatctgatgattctgattggtcaattggatggttggaacctc 27969589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 209 - 267
Target Start/End: Complemental strand, 13756580 - 13756522
Alignment:
Q  209 tagttttgctgttttggttccttgttattcacctggctgcaaggaaattgaaggttcaa 267  Q
    ||||||||||||||||||||||||||||  ||| || ||||||||| ||||||| ||||    
T  13756580 tagttttgctgttttggttccttgttatagaccaggttgcaaggaagttgaaggctcaa 13756522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 106 - 150
Target Start/End: Complemental strand, 46047109 - 46047065
Alignment:
Q  106 ctgaatctgatgattctgattggtctattgggtggttggagcctc 150  Q
    ||||||||| || |||||||||||||||||| |||||||||||||    
T  46047109 ctgaatctgttgcttctgattggtctattggctggttggagcctc 46047065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University