View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12486_high_1 (Length: 315)

Name: NF12486_high_1
Description: NF12486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12486_high_1
NF12486_high_1
[»] chr1 (1 HSPs)
chr1 (169-311)||(32184370-32184508)


Alignment Details
Target: chr1 (Bit Score: 106; Significance: 5e-53; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 169 - 311
Target Start/End: Complemental strand, 32184508 - 32184370
Alignment:
Q  169 taacaccgactaatttccattgcaaaatttatccgtcataaaacaaggcaggcgagtgcttccatctcaactggattttctccacatgaaagatttagaa 268  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||| |||||||||    
T  32184508 taacaccgactaatttccattgcaaaatttatccgtcataaaacaaggc----gagtgcttccatctcaactggattttctccacatgaaggatttagaa 32184413  T
Q  269 tcgaactcttgaccatttactgaaaatatgttagtccgttgct 311  Q
    |||||||||||||||| |||| ||||||||||| ||| |||||    
T  32184412 tcgaactcttgaccatctacttaaaatatgttattcctttgct 32184370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University