View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1247_low_62 (Length: 245)

Name: NF1247_low_62
Description: NF1247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1247_low_62
NF1247_low_62
[»] chr2 (2 HSPs)
chr2 (95-245)||(33384887-33385037)
chr2 (161-245)||(33378845-33378929)


Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 95 - 245
Target Start/End: Original strand, 33384887 - 33385037
Alignment:
Q  95 attttcccattgtatgcagctggattattgacttcatttctgttgaagttgaaaaatgatggatttcaacatgattcatcttgggagaacatgaaatctt 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33384887 attttcccattgtatgcagctggattattgacttcatttctgttgaagttgaaaaatgatggatttcaacatgattcatcttgggagaacatgaaatctt 33384986  T
Q  195 atggcggttttgtactggatggctttcttttgccacaagtaattctaaact 245  Q
    |||||||||| ||| |||||||||||||| |||||||||||||||||||||    
T  33384987 atggcggtttggtattggatggctttcttgtgccacaagtaattctaaact 33385037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 161 - 245
Target Start/End: Original strand, 33378845 - 33378929
Alignment:
Q  161 caacatgattcatcttgggagaacatgaaatcttatggcggttttgtactggatggctttcttttgccacaagtaattctaaact 245  Q
    ||||||||| | |||||||||| ||| ||||||||||| ||||| ||| ||||| |||||||| |||||||||| ||||||||||    
T  33378845 caacatgatccgtcttgggagagcataaaatcttatggtggtttggtattggattgctttcttgtgccacaagtcattctaaact 33378929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University