View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12477_low_5 (Length: 236)

Name: NF12477_low_5
Description: NF12477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12477_low_5
NF12477_low_5
[»] chr2 (2 HSPs)
chr2 (112-218)||(5688906-5689012)
chr2 (1-110)||(5689049-5689158)


Alignment Details
Target: chr2 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 112 - 218
Target Start/End: Complemental strand, 5689012 - 5688906
Alignment:
Q  112 taggtaggttggttcggattgaactaggtcttaaatagactcagctaaaatttcattgagtttatttgtgtcattaggcttgacaggtcacacataaacc 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5689012 taggtaggttggttcggattgaactaggtcttaaatagactcagctaaaatttcattgagtttatttgtgtcattaggcttgacaggtcacacataaacc 5688913  T
Q  212 cgagaac 218  Q
    |||||||    
T  5688912 cgagaac 5688906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 5689158 - 5689049
Alignment:
Q  1 tcaaaaatggtataccgtttaaatcaatattataaaagtctaaaactatactaatagacatnnnnnnnntgtcacaatttacaaacaaattggatttttg 100  Q
    |||||||| ||||||| ||||||||||||||||||||||||||||||||| ||||||||||        |||||||||||||||||||||||||||||||    
T  5689158 tcaaaaattgtataccttttaaatcaatattataaaagtctaaaactatattaatagacataaaaaaaatgtcacaatttacaaacaaattggatttttg 5689059  T
Q  101 gaattggaaa 110  Q
    ||||||||||    
T  5689058 gaattggaaa 5689049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University