View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1246_low_98 (Length: 285)

Name: NF1246_low_98
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1246_low_98
NF1246_low_98
[»] chr4 (1 HSPs)
chr4 (64-199)||(44475773-44475908)
[»] chr8 (1 HSPs)
chr8 (69-130)||(38452328-38452390)


Alignment Details
Target: chr4 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 64 - 199
Target Start/End: Complemental strand, 44475908 - 44475773
Alignment:
Q  64 aagtcagtgttaagtatttatatgagatcaccctttctcattgtcctgatctctgcataggaaaaatgaacatgagattagatgtcataaacacatagta 163  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44475908 aagtcagtgttaagtatttatatgagatcaccctttctcattgtcctgatctctgcataggaaaaatgaacatgagattagatgtcataaacacatagta 44475809  T
Q  164 catgtgatgcacaaattcataaaatatatacatgta 199  Q
    ||||||||||||||||||||||||||||||||||||    
T  44475808 catgtgatgcacaaattcataaaatatatacatgta 44475773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 130
Target Start/End: Original strand, 38452328 - 38452390
Alignment:
Q  69 agtgttaagtatttatatg-agatcaccctttctcattgtcctgatctctgcataggaaaaat 130  Q
    ||||||||| ||||||||| |||||||||||||||||  || | | |||||||||||||||||    
T  38452328 agtgttaagcatttatatggagatcaccctttctcatcatcataacctctgcataggaaaaat 38452390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University