View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1246_low_95 (Length: 286)

Name: NF1246_low_95
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1246_low_95
NF1246_low_95
[»] chr4 (1 HSPs)
chr4 (44-158)||(9684054-9684168)


Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 44 - 158
Target Start/End: Original strand, 9684054 - 9684168
Alignment:
Q  44 agtataataattagatctaatgcttgatgttgcttattgattcaaattcacgttaccataaggatgaatacaaagataaattatgtaaaaggcacaaacg 143  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||    
T  9684054 agtataataattagatctaatgcttgatgttgcttattgattcaaattcacgttaccataaggatgaatacaaaaataaatgatgtaaaaggcacaaacg 9684153  T
Q  144 aattattaatattga 158  Q
    |||||||||||||||    
T  9684154 aattattaatattga 9684168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University