View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1246_low_54 (Length: 352)

Name: NF1246_low_54
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1246_low_54
NF1246_low_54
[»] chr7 (2 HSPs)
chr7 (77-256)||(4795672-4795851)
chr7 (81-118)||(4679793-4679830)


Alignment Details
Target: chr7 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 77 - 256
Target Start/End: Original strand, 4795672 - 4795851
Alignment:
Q  77 attattctgtgatgctgctgagatatgttgatgaggttgaaaaaataaagttaccattaatgctgttacaaccaaagaaattaatgatcctttcattgta 176  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4795672 attattctgtgatgctgctgagctatgttgatgaggttgaaaaaataaagttaccattaatgctgttacaaccaaagaaattaatgatcctttcattgta 4795771  T
Q  177 ctgttggagctaatatcgaactcttgctagtttataagattgtgcagatatttaattgaatatattgtgaagattattat 256  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||    
T  4795772 ctgttggagcaaatatcgaactcttgctagtttataagattgtgcagatgtttaattgaatatagtgtgaagattattat 4795851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 81 - 118
Target Start/End: Original strand, 4679793 - 4679830
Alignment:
Q  81 ttctgtgatgctgctgagatatgttgatgaggttgaaa 118  Q
    ||||||| ||||||||||||||||||||| ||||||||    
T  4679793 ttctgtggtgctgctgagatatgttgatgtggttgaaa 4679830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University