View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1246_low_134 (Length: 223)

Name: NF1246_low_134
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1246_low_134
NF1246_low_134
[»] chr8 (1 HSPs)
chr8 (76-193)||(42955876-42955993)


Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 76 - 193
Target Start/End: Original strand, 42955876 - 42955993
Alignment:
Q  76 gcagagatacaacaatttctcagctcaaagattcactcactttattttctctctttcagtctaaaaaataccatctgatttcatgatttcaacaaaccgt 175  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| ||||    
T  42955876 gcagagatacaacaatttctcagctcaaagattcactcactttattttctctcattcagtctaaaaaataccatctgatttcatgttttcaacaagccgt 42955975  T
Q  176 gacatatataaccgatat 193  Q
    ||||||||||||||||||    
T  42955976 gacatatataaccgatat 42955993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University