View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1246_high_26 (Length: 326)

Name: NF1246_high_26
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1246_high_26
NF1246_high_26
[»] chr2 (1 HSPs)
chr2 (182-247)||(8880405-8880470)
[»] chr1 (1 HSPs)
chr1 (182-246)||(45073546-45073611)


Alignment Details
Target: chr2 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 182 - 247
Target Start/End: Complemental strand, 8880470 - 8880405
Alignment:
Q  182 ttgttagacaatgatttgtgtttggaagggaattctcatattctgcttattattaatgttaacttt 247  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8880470 ttgttagacaatgatttgtgtttggaagggaattctcatattctgcttattattaatgttaacttt 8880405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 182 - 246
Target Start/End: Complemental strand, 45073611 - 45073546
Alignment:
Q  182 ttgttagacaatgatttgtgtttggaagggaa-ttctcatattctgcttattattaatgttaactt 246  Q
    |||||||||||||||||||||||||||||||| || |||| |||||||||||||| | ||||||||    
T  45073611 ttgttagacaatgatttgtgtttggaagggaacttatcatgttctgcttattattgacgttaactt 45073546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University