View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1245_low_19 (Length: 452)

Name: NF1245_low_19
Description: NF1245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1245_low_19
NF1245_low_19
[»] chr4 (1 HSPs)
chr4 (283-423)||(17656985-17657125)


Alignment Details
Target: chr4 (Bit Score: 137; Significance: 2e-71; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 283 - 423
Target Start/End: Complemental strand, 17657125 - 17656985
Alignment:
Q  283 tacttttaaatcattatatttatttttgtatttatgattgttaaaaatacatcaatacataataaagataatttcgtaaaagtgtaatttcttttgataa 382  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  17657125 tacttttaaatcattatatttatttttgtatttatgattgttaaaaatacatcaatagataataaagataatttcgtaaaagtgtaatttcttttgataa 17657026  T
Q  383 tattttattgtattcctaatttgtatgtaaatacttaaaac 423  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  17657025 tattttattgtattcctaatttgtatgtaaatacttaaaac 17656985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University