View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1244_low_44 (Length: 248)

Name: NF1244_low_44
Description: NF1244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1244_low_44
NF1244_low_44
[»] chr1 (2 HSPs)
chr1 (17-156)||(36254103-36254241)
chr1 (182-231)||(36254263-36254312)


Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 17 - 156
Target Start/End: Original strand, 36254103 - 36254241
Alignment:
Q  17 tttattctaaacgtaggttcattgtaattttatctcattgatagatcggtatggtatcacatatatacatgaatactcatattagactgaatatcataca 116  Q
    |||||||||||| ||||||||| |||||||||||||||||||||  ||||||||||||||||||||||||||||||||| ||||||||| ||| ||||||    
T  36254103 tttattctaaacttaggttcatagtaattttatctcattgatagc-cggtatggtatcacatatatacatgaatactcacattagactggataccataca 36254201  T
Q  117 agtccatccattagataaaattacgagtattcatgaatac 156  Q
    | | ||||||||||||||||||||||||||||||||||||    
T  36254202 aattcatccattagataaaattacgagtattcatgaatac 36254241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 182 - 231
Target Start/End: Original strand, 36254263 - 36254312
Alignment:
Q  182 aatagttttatcacatatatacatgaatactcgtatcatgagatactttt 231  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36254263 aatagttttatcacatatatacatgaatactcgtatcatgagatactttt 36254312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University