View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1244_high_18 (Length: 374)

Name: NF1244_high_18
Description: NF1244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1244_high_18
NF1244_high_18
[»] scaffold0565 (1 HSPs)
scaffold0565 (10-280)||(5201-5471)


Alignment Details
Target: scaffold0565 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: scaffold0565
Description:

Target: scaffold0565; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 10 - 280
Target Start/End: Original strand, 5201 - 5471
Alignment:
Q  10 aataatatagcaaggaacttgttgtgcaactccaattccactccacaaactcaaaaccaacactactatccctatattcatcatagagaggtccaaaaat 109  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5201 aataaaatagcaaggaacttgttgtgcaactccaattccactccacaaactcaaaaccaacactactatccctatattcatcatagagaggtccaaaaat 5300  T
Q  110 gccattgaaaaatgaggtaaataattgtaatggctaatggggtgtgtgtggaaagagagagggaattggatgatgaaaatgtgaaatgagcaaagctata 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5301 gccattgaaaaatgaggtaaataattgtaatggctaatggggtgtgtgtggaaagagagagggaattggatgatgaaaatgtgaaatgagcaaagctata 5400  T
Q  210 tatgtagtggtggatgaggcaaagatttctaaaggcttttacgtatggttgaggatattttggtagaagct 280  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  5401 tatgtagtggtggatgaggcaaagatttctaaaggcttttacgtacggttgaggatattttggtagaagct 5471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University