View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1243_low_105 (Length: 256)

Name: NF1243_low_105
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1243_low_105
NF1243_low_105
[»] chr7 (1 HSPs)
chr7 (34-146)||(30319669-30319782)


Alignment Details
Target: chr7 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 34 - 146
Target Start/End: Original strand, 30319669 - 30319782
Alignment:
Q  34 aggcaccattggaaatgacccatttgcttcctaatcatnnnnnnncaatctttttcaatttttaacactacccac-nnnnnnnntcagctagatccatga 132  Q
    ||||||||||||||||||||||||||||||||||||||       ||||| ||||||||||||||||||||||||         ||||||||||||||||    
T  30319669 aggcaccattggaaatgacccatttgcttcctaatcataaaaaaacaatccttttcaatttttaacactacccacaaaaaaaaatcagctagatccatga 30319768  T
Q  133 attaaattcaaaag 146  Q
    ||||||||||||||    
T  30319769 attaaattcaaaag 30319782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University