View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12427_high_6 (Length: 299)

Name: NF12427_high_6
Description: NF12427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12427_high_6
NF12427_high_6
[»] chr4 (1 HSPs)
chr4 (23-299)||(45565762-45566038)
[»] chr7 (1 HSPs)
chr7 (109-170)||(8179388-8179449)


Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 23 - 299
Target Start/End: Complemental strand, 45566038 - 45565762
Alignment:
Q  23 gggatgagttagatagatttaggggcagcgtgcaagcttcccaaattgggcgctctaaggaggtacatatttgaatgggaggattattggcacaagcaga 122  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  45566038 gggatgagttagagagatttaggggcagcgtgcaagcttcccaaattgcgcgctctaaggaggtacatatttgaatgagaggattattggcacaagcaga 45565939  T
Q  123 agcattttggaaacaaatagcaaaggtgatttggcttaaggatggtgacaccaatgcgcgattctttcaagccatggcgagtgcaaagagatgatgcaat 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45565938 agcattttggaaacaaatagcaaaggtgatttggcttaaggatggtgataccaatgcgcgattctttcaagccatggcgagtgcaaagagatgatgcaat 45565839  T
Q  223 acttttacaaacttgaagaaagatgataggactttggttgtggcgcaacatgaactttacgtggttgctagctccta 299  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45565838 acttttacaaacttgaagaaagatgataggactttggttgtggcgcaacatgaactttacgtggttgctagctccta 45565762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 8179449 - 8179388
Alignment:
Q  109 ttggcacaagcagaagcattttggaaacaaatagcaaaggtgatttggcttaaggatggtga 170  Q
    |||||||||| |||||| |||||||| |||| ||| |||||||||||||| |||||||||||    
T  8179449 ttggcacaagaagaagcgttttggaagcaaagagctaaggtgatttggctgaaggatggtga 8179388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University