View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1241_low_43 (Length: 245)

Name: NF1241_low_43
Description: NF1241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1241_low_43
NF1241_low_43
[»] chr7 (1 HSPs)
chr7 (20-221)||(25482904-25483105)


Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 221
Target Start/End: Complemental strand, 25483105 - 25482904
Alignment:
Q  20 atcacatgggaatggatattattgtcgaaggatgaaaatagtttactatcaccgttgctaaataaaagtcaccgttgctaaataaaagacacatttgagt 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25483105 atcacatgggaatggatattattgtcgaaggatgaaaatagtttactatcaccgttgctaaataaaagtcaccgttgctaaataaaagacacatttgagt 25483006  T
Q  120 tttctttgtctctatttattgtaactcaacaacatcaccaaacaaacacgaagcacttatgagctataaagtccgactagtacaaaagagagacgtaccc 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25483005 tttctttgtctctatttattgtaactcaacaacatcaccaaacaaacacgaagcacttatgagctataaagtccgactagtacaaaagagagacgtaccc 25482906  T
Q  220 gt 221  Q
    ||    
T  25482905 gt 25482904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University