View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1241_low_39 (Length: 251)

Name: NF1241_low_39
Description: NF1241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1241_low_39
NF1241_low_39
[»] chr1 (2 HSPs)
chr1 (1-234)||(49671040-49671273)
chr1 (100-184)||(49675289-49675373)


Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 49671273 - 49671040
Alignment:
Q  1 caatgagcttgctgtctctatggcaattttcattctgatatgccagggcagtgtgcctggtcttgctagatcaccgtggagatggcaatcaacactgtga 100  Q
    ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||  ||||||||||||||||||||| |||||    
T  49671273 caatgagcttgctgtctctatggcaattttcatcctgatatgccatggcagtgtgcctgatcttgctagattgccgtggagatggcaatcaacagtgtga 49671174  T
Q  101 tttgaaacatattcatacacgagcagtagttcattgctgtgatatgaagtacagccatagagggatacaaggtttgtgtggcgcgtgcgagcaaggatct 200  Q
    |||| ||||||||| ||||||||||||||||| ||||||||||||||||||| |||||| ||||||||||| || |||||||| ||||||||||||||||    
T  49671173 tttggaacatattcgtacacgagcagtagttcgttgctgtgatatgaagtactgccataaagggatacaagattcgtgtggcgtgtgcgagcaaggatct 49671074  T
Q  201 caatttcatttgtgaactgttctactcgcctcca 234  Q
    |||||||||| |||||||||||||||||||||||    
T  49671073 caatttcattcgtgaactgttctactcgcctcca 49671040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 184
Target Start/End: Complemental strand, 49675373 - 49675289
Alignment:
Q  100 atttgaaacatattcatacacgagcagtagttcattgctgtgatatgaagtacagccatagagggatacaaggtttgtgtggcgc 184  Q
    ||||||||  |||||||| || |||| ||||||||  || |||| |||||||||||||||||| || || || ||| ||||||||    
T  49675373 atttgaaatgtattcatatacaagcaatagttcatgactatgatgtgaagtacagccatagagagaaactagatttctgtggcgc 49675289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University