View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12419_low_59 (Length: 208)

Name: NF12419_low_59
Description: NF12419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12419_low_59
NF12419_low_59
[»] chr5 (2 HSPs)
chr5 (12-126)||(22770822-22770936)
chr5 (120-192)||(22770595-22770667)


Alignment Details
Target: chr5 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 12 - 126
Target Start/End: Complemental strand, 22770936 - 22770822
Alignment:
Q  12 acctgtggaatagaaatctttcaactgttagatcaatctatgcactttaacatccacatggacatcaaatatatgtgtttgttgaaattaaatttgtaat 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||||    
T  22770936 acctgtggaatagaaatctttcaactgttagatcaatctatgcactttaacatccacatggacatcaaatatatgtttttcttgaaattaaacttgtaat 22770837  T
Q  112 agcatttttatgaaa 126  Q
    |||||||| ||||||    
T  22770836 agcattttcatgaaa 22770822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 120 - 192
Target Start/End: Complemental strand, 22770667 - 22770595
Alignment:
Q  120 tatgaaacccattttattttagtaaagttacaatacagtacctattacggcattcttcaaatgacgatcattt 192  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  22770667 tatgaaacccattttattttagtaaagttacaatacagtacctattacggcattcttcaaatgacgatcattt 22770595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University