View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1240_low_83 (Length: 236)

Name: NF1240_low_83
Description: NF1240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1240_low_83
NF1240_low_83
[»] chr8 (1 HSPs)
chr8 (1-120)||(5783411-5783530)


Alignment Details
Target: chr8 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 5783411 - 5783530
Alignment:
Q  1 tcgaccaattcttctccataatatgaaaatatatatgtccgaaatttggaggtcagtgaaaggtgtgatagtgaaagaagcatatccatgactgtttcaa 100  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  5783411 tcgaccaattcatctccataatatgaaaatatatatgtccgaaatttggaggtcagtgaaaggtgtgatagtgaaagaagcatatccaggactgtttcaa 5783510  T
Q  101 tttcaattatgccataaatt 120  Q
    ||||||||||||||||||||    
T  5783511 tttcaattatgccataaatt 5783530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University