View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1240_low_49 (Length: 316)

Name: NF1240_low_49
Description: NF1240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1240_low_49
NF1240_low_49
[»] chr7 (1 HSPs)
chr7 (96-238)||(17258437-17258579)


Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 96 - 238
Target Start/End: Original strand, 17258437 - 17258579
Alignment:
Q  96 agatgattcacttattatcaaaacttttcaaggacgtttctatagcatgtatttattaattttgcttcattattgtctgtaggatatcttggaatgtggc 195  Q
    |||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||| ||||||||||||| |||||| ||    
T  17258437 agatgattcacttattatcaaaacttttcaaggacgtttctgcagcatgtatttattaattttgcttcattattgtatgtaggatatcttagaatgtcgc 17258536  T
Q  196 gattcttgctgcaacacagctataattgagactccgatcagta 238  Q
    |||||||||||||||||| |||||||||||||| |||||||||    
T  17258537 gattcttgctgcaacacaactataattgagacttcgatcagta 17258579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University