View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12391_low_6 (Length: 211)

Name: NF12391_low_6
Description: NF12391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12391_low_6
NF12391_low_6
[»] chr7 (1 HSPs)
chr7 (18-126)||(28681270-28681379)
[»] chr6 (1 HSPs)
chr6 (113-154)||(7818002-7818043)


Alignment Details
Target: chr7 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 18 - 126
Target Start/End: Complemental strand, 28681379 - 28681270
Alignment:
Q  18 agaagaattgtcctcgtgctcgtgcccaaagagatgtaaactttcatttggacataagcattgttactagaattatcagtgttgttctaacatgaaacc- 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||     
T  28681379 agaagaattgtcctcgtgctcgtgcccaaagagatgtaaactttcatttgaacataagtattgttactagaattatcagtgttgttctaacatgaaacca 28681280  T
Q  117 atttagtttg 126  Q
    ||||||||||    
T  28681279 atttagtttg 28681270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 113 - 154
Target Start/End: Complemental strand, 7818043 - 7818002
Alignment:
Q  113 aaccatttagtttgatactttggacaatatatacatgcttgg 154  Q
    ||||||||||||||||| ||||||||| ||||| ||||||||    
T  7818043 aaccatttagtttgatagtttggacaaaatatatatgcttgg 7818002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University