View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12335_high_3 (Length: 241)

Name: NF12335_high_3
Description: NF12335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12335_high_3
NF12335_high_3
[»] chr1 (1 HSPs)
chr1 (1-103)||(7364445-7364547)


Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 7364445 - 7364547
Alignment:
Q  1 atgctgctgctcgtaaactttatggttctgatgcaaaacttaacctcccagaactttctacaccccctcaaaatactacttcatcaccctctcctacacc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7364445 atgctgctgctcgtaaactttatggttctgatgcaaaacttaacctcccagaactttctacaccccctcaaaatactacttcatcaccctctcctacacc 7364544  T
Q  101 acc 103  Q
    |||    
T  7364545 acc 7364547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University