View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12330_low_8 (Length: 214)

Name: NF12330_low_8
Description: NF12330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12330_low_8
NF12330_low_8
[»] chr4 (2 HSPs)
chr4 (166-214)||(24524471-24524519)
chr4 (1-34)||(24524526-24524559)
[»] chr3 (2 HSPs)
chr3 (1-36)||(9122575-9122610)
chr3 (1-36)||(9130671-9130706)


Alignment Details
Target: chr4 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 166 - 214
Target Start/End: Complemental strand, 24524519 - 24524471
Alignment:
Q  166 gctagtcctaggggatttgtttgtttctctatggtagccgtttggtttt 214  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
T  24524519 gctagtcctaggggatttgtttgtttctctatggtagccgtttggtttt 24524471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 24524559 - 24524526
Alignment:
Q  1 tttctgtccgctgaattgttggtgctgttctgct 34  Q
    |||||||| |||||||||||||||||||||||||    
T  24524559 tttctgtcggctgaattgttggtgctgttctgct 24524526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 9122610 - 9122575
Alignment:
Q  1 tttctgtccgctgaattgttggtgctgttctgctgc 36  Q
    |||||||| |||||||||||||||||||||||||||    
T  9122610 tttctgtcggctgaattgttggtgctgttctgctgc 9122575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 9130706 - 9130671
Alignment:
Q  1 tttctgtccgctgaattgttggtgctgttctgctgc 36  Q
    |||||||| |||||||||||||||||||||||||||    
T  9130706 tttctgtcggctgaattgttggtgctgttctgctgc 9130671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University