View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12317_high_2 (Length: 326)

Name: NF12317_high_2
Description: NF12317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12317_high_2
NF12317_high_2
[»] chr6 (1 HSPs)
chr6 (84-312)||(15964910-15965149)
[»] chr5 (1 HSPs)
chr5 (223-274)||(40796743-40796794)
[»] chr3 (1 HSPs)
chr3 (223-252)||(536661-536690)


Alignment Details
Target: chr6 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 84 - 312
Target Start/End: Original strand, 15964910 - 15965149
Alignment:
Q  84 gaattttgtggtcatttgtgatggagttggaggcttttagcttattatttggatgctgctggtttaagggggttttgttgggttttggtgtaggctttgg 183  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15964910 gaattttgtggtcatttgtgatggagttggaggcttttagcttattatttggatgctgctggtttaagggggttttgttgggttttggtgtaggctttgg 15965009  T
Q  184 agg------------nnnnnnnnattggtgttgatgatagccattgtggaattgtgtctttattggtgtttatgatgtacgatatatgtgttttcttcta 271  Q
    |||                    ||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  15965010 aggtttttttttctttttctttaattggtgttgatgatagccgttgtggaattgtgtctttattgatgtttatgatgtacgatatatgtgttttcttcta 15965109  T
Q  272 ggtgtttcgactatgtacgacaccttttgatatgtagtttc 312  Q
    |||||||||||||||||||| ||||||||||||||||||||    
T  15965110 ggtgtttcgactatgtacga-accttttgatatgtagtttc 15965149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Original strand, 40796743 - 40796794
Alignment:
Q  223 ttgtgtctttattggtgtttatgatgtacgatatatgtgttttcttctaggt 274  Q
    |||||||||||||||||||||||||||||||| ||||| ||||||| |||||    
T  40796743 ttgtgtctttattggtgtttatgatgtacgatgtatgtattttcttttaggt 40796794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 252
Target Start/End: Complemental strand, 536690 - 536661
Alignment:
Q  223 ttgtgtctttattggtgtttatgatgtacg 252  Q
    ||||||||||||||||||||||||||||||    
T  536690 ttgtgtctttattggtgtttatgatgtacg 536661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University