View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12300_low_11 (Length: 210)

Name: NF12300_low_11
Description: NF12300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12300_low_11
NF12300_low_11
[»] chr3 (1 HSPs)
chr3 (69-194)||(51463365-51463491)


Alignment Details
Target: chr3 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 69 - 194
Target Start/End: Original strand, 51463365 - 51463491
Alignment:
Q  69 ctcccagaatgtacgattgcttgtcagcaatccacatatatgatcccc-acgtctgtgaaactaaaaatattgtttaagatcattcccaatggtgatgtc 167  Q
    |||||||||||||||||| ||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |||||||||| ||||||||||||||    
T  51463365 ctcccagaatgtacgattacttgtcagcaatcgacatatatgatcccccacgtctgtgaaactaaaaatattgtctaagatcatttccaatggtgatgtc 51463464  T
Q  168 ttcaccatttaagacataatatctgat 194  Q
    |||| |||||||||| | |||||||||    
T  51463465 ttcatcatttaagacctgatatctgat 51463491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University