View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12297_low_5 (Length: 249)

Name: NF12297_low_5
Description: NF12297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12297_low_5
NF12297_low_5
[»] chr5 (2 HSPs)
chr5 (18-104)||(3939321-3939407)
chr5 (165-230)||(3939006-3939071)


Alignment Details
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 18 - 104
Target Start/End: Complemental strand, 3939407 - 3939321
Alignment:
Q  18 agacaaacattagaatttaaagtgaagtttgacaattattgtaaatttagctagtgagaagtgacactcataccagttcaaaacgaa 104  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||  |||||||||    
T  3939407 agacaaacattagaatttaaagtgaagtttgacaattattgtaactttagctagtgagaagtgacactcataccagaccaaaacgaa 3939321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 165 - 230
Target Start/End: Complemental strand, 3939071 - 3939006
Alignment:
Q  165 gagagttttgagtaggggaaaatctaactgaggacagatatacattttcagtgacttcaacttgag 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3939071 gagagttttgagtaggggaaaatctaactgaggacagatatacattttcagtgacttcaacttgag 3939006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University