View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12286_low_3 (Length: 237)

Name: NF12286_low_3
Description: NF12286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12286_low_3
NF12286_low_3
[»] chr7 (1 HSPs)
chr7 (16-219)||(24639026-24639229)


Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 16 - 219
Target Start/End: Original strand, 24639026 - 24639229
Alignment:
Q  16 agcaaagggcaaatgaaaaacacattaaccaataaccagcaaaagaaatgaagaagtttgaacctaatgtagtagctcaaacaatggctctttaaccgct 115  Q
    |||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||   |||||||| |||||| ||||||||| ||    
T  24639026 agcaaaaggcaaatgaaaaacacattaacgaataaccagcaaaagaaatgaagaagtttgaacctgatgatctagctcaagcaatggttctttaacctct 24639125  T
Q  116 gttgaatgagctgatagggttgtgagagcaccagtactacgattgccgattagtgcggtgatttagcagacgaagtctcggcgggcggaatcgcctactc 215  Q
    | |||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |||    
T  24639126 gctgaatgagctgatagggttgtgagagcaccggtactacgattgccgattggtgcggtgatttagcagacgaagtctcggcggccggaatcgccttctc 24639225  T
Q  216 ttgt 219  Q
    ||||    
T  24639226 ttgt 24639229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University