View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12265_high_6 (Length: 234)

Name: NF12265_high_6
Description: NF12265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12265_high_6
NF12265_high_6
[»] chr2 (2 HSPs)
chr2 (72-220)||(1432456-1432604)
chr2 (112-149)||(1451198-1451235)


Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 72 - 220
Target Start/End: Original strand, 1432456 - 1432604
Alignment:
Q  72 cttctcacatttgcttcaatgtatagtattatagttagcctagtatttaggtgtatgctactaaggctgtctaatgaaagtcgaaattcaagttactgaa 171  Q
    ||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||    
T  1432456 cttctcacatttgctttgatgtatagtattatagttagcctagtatttaggtgtatgctactaaggctgtctaatgaaagtcgaggttcaagttactgaa 1432555  T
Q  172 tattattaaggatgtttgaatctgaatattgcttccttttagcacaggt 220  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||    
T  1432556 tattattaaggatgtttgaaactgaatattgcttccttttagcacaggt 1432604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 112 - 149
Target Start/End: Original strand, 1451198 - 1451235
Alignment:
Q  112 tagtatttaggtgtatgctactaaggctgtctaatgaa 149  Q
    ||||||||||||||||||||||||||||| ||| ||||    
T  1451198 tagtatttaggtgtatgctactaaggctgactagtgaa 1451235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University