View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12254_high_11 (Length: 205)

Name: NF12254_high_11
Description: NF12254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12254_high_11
NF12254_high_11
[»] chr5 (1 HSPs)
chr5 (7-187)||(14732852-14733032)


Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 7 - 187
Target Start/End: Original strand, 14732852 - 14733032
Alignment:
Q  7 gaggagcagagagaccagaattggaggaaatagcctaaggaatagtttttgttttgatgatataagaaagagtcatggcttaagaagacaaagtacacaa 106  Q
    ||||| |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14732852 gaggaacagaaagaccagaattggaggaaatagcctaaggaatggtttttgttttgatgatataagaaagagtcatggcttaagaagacaaagtacacaa 14732951  T
Q  107 aaagttttggcccgtgaagtttgcatgtgatcattaagagctgttataatcagtgcccttgcacattatagacccactcac 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14732952 aaagttttggcccgtgaagtttgcatgtgatcattaagagctgttataatcagtgcccttgcacattatagacccactcac 14733032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University